جلسه پنجم: متن و کاراکتر

درسنامه درس 5 از سری شروع بکار در متلب
آموزش متن و کاراکتر متلب

متن در آرایه های رشته ای

وقتی شما در حال کار با متن در متلب هستید، سری کاراکترهای مربوط به متن خود را در میان علامت نقل قول یا double quotes (" ") قرار دهید. در متلب شما می توانید متن را مشابه یک متغیر فرض کنید.

t = "Hello, world";

اگر متنی که قصد استفاده از آن را دارید خود شامل علامت نقل قول است، از دو دابل کوت برای درج آن استفاده کنید.

q = "Something ""quoted"" and something else."
 q =
      "Something "quoted" and something else."

آرایه های t و q،  مانند هر متغیر دیگری در متلب هستند. class یا نوع داده آن ها رشته ای(string) است.

whos t
  Name        Size            Bytes  Class     Attributes

  t           1x1               174  string

توجه: ایجاد آرایه رشته ای با استفاده از علامت نقل قول پس از نسخه R2017a متلب معرفی شده است. در صورتی که از نسخه های قدیمی تر این محصول استفاده می کنید، آرایه های کاراکتری ایجاد کنید. برای توضیحات به بخش پایانی همین مطلب مراجعه کنید.

برای اضافه کردن هر نوع متغیر به انتهای یک رشته می توانید از عملگر بعلاوه (+) استفاده کنید.

f = 71;

c = (f-32)/1.8;

tempText = "Temperature is " + c + "C"
tempText =
      "Temperature is 21.6667C"

مانند آرایه های عددی، آرایه های رشته ای هم از چندین المان تشکیل شده اند. برای پیدا کردن طول هر رشته در یک آرایه از دستور strlength استفاده کنید.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
A =

2×3 string array

"a"       "bb"        "ccc"

"dddd"    "eeeeee"    "fffffff"
strlength(A)
ans =
      1     2     3     4     6     7

داده ها در آرایه های کاراکتری

گاهی اوقات کاراکترها حاوی داده هایی هستند که به یک متن منسجم اشاره نمی کنند؛ مانند سری DNA. شما می توانید این نوع از داده را در یک آرایه کاراکتری ذخیره کنید؛ که نوع داده char را شامل می شود. آرایه های کاراکتری از آپاستروف یا single quotes (‘ ‘) برای تعریف استفاده می کنند.

seq = 'GCTAGAATCC';
whos seq

Name      Size            Bytes  Class    Attributes

seq       1x10               20  char

هر المان از این نوع آرایه حاوی یک تک کاراکتر است؛ بدین صورت که:

seq(4)ans =     'A'

برای چسباندن چند آرایه مانند آنچه در اتصال آرایه های عددی مشاهده کردید، از کروشه های باز و بسته [ ] استفاده کنید.

seq2 = [seq 'ATTAGAAACC']
seq2 =
    'GCTAGAATCCATTAGAAACC'

آرایه های کاراکتری در برنامه هایی که پیش از معرفی آرایه های رشته ای نوشته شده اند مشترک هستند. همه توابع متلب که داده ای string را قبول می کنند، داده های char را نیز قبول خواهند کرد و بالعکس.


منبع: سایت MathWorks

تمام فصل‌های سری ترتیبی که روکسو برای مطالعه‌ی دروس سری شروع بکار در متلب توصیه می‌کند:
نویسنده شوید

دیدگاه‌های شما

در این قسمت، به پرسش‌های تخصصی شما درباره‌ی محتوای مقاله پاسخ داده نمی‌شود. سوالات خود را اینجا بپرسید.

ما را دنبال کنید
اینستاگرام روکسو تلگرام روکسو ایمیل و خبرنامه روکسو